View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21082_high_13 (Length: 327)
Name: NF21082_high_13
Description: NF21082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21082_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 72 - 313
Target Start/End: Complemental strand, 44919705 - 44919475
Alignment:
| Q |
72 |
ttggaaccttttggactttcctttttgggtatagtatgattcttcacttgttaattgttgttgattattggttggggttggtaccaccaccaccttgatt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44919705 |
ttggaaccttttggactttcctttttgggtatagtatgattcttcacttgttaattgttgttgattattggttggggttggtaccaccaccaccttgatt |
44919606 |
T |
|
| Q |
172 |
gccaataaaaggttctattctgggtctctctggaatatattatct--tatatagttgggaagaagtagaaaaaatgaatnnnnnnntgggctaatagtat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44919605 |
gccaataaaaggttctattctgggtctctctggaatatattatattatatatagttgggaagaagtagaaaaa-------------tgggctaatagtat |
44919519 |
T |
|
| Q |
270 |
atatcttcacaactatggaacattggtgcatgatgatgctatct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44919518 |
atatcttcacaactatggaacattggtgcatgatgatgctatct |
44919475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 44919752 - 44919827
Alignment:
| Q |
1 |
cttcttattgctagtagatatagtctttgattcgatgtgggcctaaatgaggccaactatggaaataaattttgga |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44919752 |
cttcttattgctagtagatatagtctttgattcgatgtgggcctaaatgaggccaactatggaaataaattttgga |
44919827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University