View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21082_high_14 (Length: 327)
Name: NF21082_high_14
Description: NF21082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21082_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 44919776 - 44919475
Alignment:
| Q |
1 |
gactatatctactagcaataagaagagaaagaatttaggcagctggtctgtacagtttgaggctatgtatgtcggaaccttttggactttcctttttggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44919776 |
gactatatctactagcaataagaagagaaagaatttaggcagctggtctgtacagtttgaggctatgtatgttggaaccttttggactttcctttttggg |
44919677 |
T |
 |
| Q |
101 |
tatagtatgattcttcacttgttaattgttgttgattattggttggggttggtaccaccaccaccttgattgccaataaaaggttctattctgggtctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44919676 |
tatagtatgattcttcacttgttaattgttgttgattattggttggggttggtaccaccaccaccttgattgccaataaaaggttctattctgggtctct |
44919577 |
T |
 |
| Q |
201 |
ctggaatatattatct--tatatagttgggaagaagtagaaaaaatgaatnnnnnnntgggctaatagtatatatcttcacaactatggaacattggtgc |
298 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44919576 |
ctggaatatattatattatatatagttgggaagaagtagaaaaa-------------tgggctaatagtatatatcttcacaactatggaacattggtgc |
44919490 |
T |
 |
| Q |
299 |
atgatgatgctatct |
313 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44919489 |
atgatgatgctatct |
44919475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University