View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21082_low_15 (Length: 255)

Name: NF21082_low_15
Description: NF21082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21082_low_15
NF21082_low_15
[»] chr4 (1 HSPs)
chr4 (46-118)||(26309816-26309888)


Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 46 - 118
Target Start/End: Original strand, 26309816 - 26309888
Alignment:
46 agggccatcctgtcacagcaaccacagtctctatgtcttggaatcccattccacttaaagcagaatgtacagc 118  Q
    |||||||||||||  |||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||    
26309816 agggccatcctgtttcagctaccacaatttctatgtcttggaatcccattccacttaaagcagaatgtacagc 26309888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University