View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21082_low_18 (Length: 240)
Name: NF21082_low_18
Description: NF21082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21082_low_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 240
Target Start/End: Complemental strand, 43378201 - 43377981
Alignment:
| Q |
16 |
caaaaatcatactataaagcatccaaagaaaaatcatactatgaggaaaattctcttgacaattaatgtaaatgcttgttgcatatttatctctcttgtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
43378201 |
caaaaatcatactataaagcatccaaagaaaaatcatactatgaggaaaattctcttgacaat----gtaaatgcttgttgcatatttatctctcttgat |
43378106 |
T |
 |
| Q |
116 |
cctgtccaaaaggcaagggaaaaaattgatgtacataacaggtatccgacaaaataaaacatatataatcacaataaattccctttagggttattaaaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43378105 |
cctgtccaaaaggcaagggaaaaaattgatttacataacaggtatccgacaaaataaaacatatataatcacaataaattccctttagggttattaaaat |
43378006 |
T |
 |
| Q |
216 |
acatgtctgtactcagcattctgtc |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43378005 |
acatgtctgtactcagcattctgtc |
43377981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University