View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21083_high_5 (Length: 239)
Name: NF21083_high_5
Description: NF21083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21083_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 123
Target Start/End: Original strand, 36689349 - 36689454
Alignment:
| Q |
18 |
attgggtgcccttacagaaacgaatataaaatgtttttatctagttgtagatatatgttctcctcaaatgctagattcattccatataagtaattgttat |
117 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36689349 |
attgggtgcccttacggaaacgaatatagaatgtttttatctagttgtagatatatgttctcctcaaatgctagattcattccatataagtaattgttat |
36689448 |
T |
 |
| Q |
118 |
tatatg |
123 |
Q |
| |
|
|||||| |
|
|
| T |
36689449 |
tatatg |
36689454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 162 - 239
Target Start/End: Original strand, 36689523 - 36689600
Alignment:
| Q |
162 |
aaaaagatttacactaaacttaaattgagcttcaaagtaaaccaatgtttattaagatgagatcagattgattcgact |
239 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||| |||||||||| ||||| |||| |||||||| |
|
|
| T |
36689523 |
aaaaagatttgcattaaacttaaattgagcttcaaagtaaaccaatatttattaagacgagatgagatccattcgact |
36689600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University