View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21083_low_5 (Length: 250)
Name: NF21083_low_5
Description: NF21083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21083_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 10 - 243
Target Start/End: Complemental strand, 36690052 - 36689834
Alignment:
| Q |
10 |
attatactagtagtatttgtagtacaatactggtaatgtaatgtttattatgatgatgaaaaagatttaagttaagatatttgcacgagggggaaacccn |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36690052 |
attatactagtagtatttgtagtacaatactggtaatgtaatgtttattatgatgatgaaaaagatttaagttaagatatttgcacgagggggaaaccca |
36689953 |
T |
 |
| Q |
110 |
nnnnnngaataggaaataaaatagttgagtgtgggtcactcactcactttttctgcagtaacttggttcgtattttacgaatgctcgttcagtgtccaca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36689952 |
aaaaaagaataggaaataaaatagttgagtgtgggtcactcactc---------------acttggttcgtattttacgaatgctcgttcagtgtccaca |
36689868 |
T |
 |
| Q |
210 |
cgctagttttgtcgtgtttaaactttaaatactc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36689867 |
cgctagttttgtcgtgtttaaactttaaatactc |
36689834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University