View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21084_low_6 (Length: 232)
Name: NF21084_low_6
Description: NF21084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21084_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 5 - 217
Target Start/End: Original strand, 43407766 - 43407972
Alignment:
| Q |
5 |
tgacatgaatgatatcttctgatctttttatataggaggatctgagaaagaactttaattataaggatggaatatggtggtgggttagtggctgacggtg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407766 |
tgacatgaatgatatcttctgatctttttatataggaggatctgagaaacaactttaattataaggatggaatatggtggtgggttagtggctgacggtg |
43407865 |
T |
 |
| Q |
105 |
gtgtgtttggaccgatggtgnnnnnnnnnnnnnnnnnnnnnnatcaagcagatataattgaggagctcttgggagaaggttgctggattgaagcaagtga |
204 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43407866 |
gtgtgtttggaccgatggtg------ggaggaggaggaggagatcaagcagatataattgaggagctgttgggagaaggttgctggattgaagcaagtga |
43407959 |
T |
 |
| Q |
205 |
gaacagtttgatg |
217 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
43407960 |
gaatagtttgatg |
43407972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University