View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21084_low_6 (Length: 232)

Name: NF21084_low_6
Description: NF21084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21084_low_6
NF21084_low_6
[»] chr5 (1 HSPs)
chr5 (5-217)||(43407766-43407972)


Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 5 - 217
Target Start/End: Original strand, 43407766 - 43407972
Alignment:
5 tgacatgaatgatatcttctgatctttttatataggaggatctgagaaagaactttaattataaggatggaatatggtggtgggttagtggctgacggtg 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
43407766 tgacatgaatgatatcttctgatctttttatataggaggatctgagaaacaactttaattataaggatggaatatggtggtgggttagtggctgacggtg 43407865  T
105 gtgtgtttggaccgatggtgnnnnnnnnnnnnnnnnnnnnnnatcaagcagatataattgaggagctcttgggagaaggttgctggattgaagcaagtga 204  Q
    ||||||||||||||||||||                      ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
43407866 gtgtgtttggaccgatggtg------ggaggaggaggaggagatcaagcagatataattgaggagctgttgggagaaggttgctggattgaagcaagtga 43407959  T
205 gaacagtttgatg 217  Q
    ||| |||||||||    
43407960 gaatagtttgatg 43407972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University