View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21085_high_5 (Length: 279)
Name: NF21085_high_5
Description: NF21085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21085_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 5399635 - 5399880
Alignment:
| Q |
18 |
cttctttcattcctagtaactctgctgccgttataacggctgcaatgtttgttggtgttaaatggattttacggttgtaacaaaattctgcaacggttgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5399635 |
cttctttcattcctagtaactctgctgtcgttataacggctgcaatgtttgttggtgttaaatggattttacggttgtaacaaaattctgcaacggttgt |
5399734 |
T |
 |
| Q |
118 |
gaatgttgaagccgttatgtttaatggtggggagagtgtgaagtcggagagggatgttaggtggcgttttagatatgagcttcgtgatatgaaacgttcc |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5399735 |
gaatgatgaagccgttatgtttaatggtggggagagtgtgaagtcggagagggatgttaggtggcgttttagatatgagcttcgtgatatgaaacgttcc |
5399834 |
T |
 |
| Q |
218 |
tgaaaaaagagatacatagtaagctatatatataccatcaatcaca |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5399835 |
tgaaaaaagagatacatagtaagctatatatataccatcaatcaca |
5399880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University