View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21085_high_5 (Length: 279)

Name: NF21085_high_5
Description: NF21085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21085_high_5
NF21085_high_5
[»] chr5 (1 HSPs)
chr5 (18-263)||(5399635-5399880)


Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 5399635 - 5399880
Alignment:
18 cttctttcattcctagtaactctgctgccgttataacggctgcaatgtttgttggtgttaaatggattttacggttgtaacaaaattctgcaacggttgt 117  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5399635 cttctttcattcctagtaactctgctgtcgttataacggctgcaatgtttgttggtgttaaatggattttacggttgtaacaaaattctgcaacggttgt 5399734  T
118 gaatgttgaagccgttatgtttaatggtggggagagtgtgaagtcggagagggatgttaggtggcgttttagatatgagcttcgtgatatgaaacgttcc 217  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5399735 gaatgatgaagccgttatgtttaatggtggggagagtgtgaagtcggagagggatgttaggtggcgttttagatatgagcttcgtgatatgaaacgttcc 5399834  T
218 tgaaaaaagagatacatagtaagctatatatataccatcaatcaca 263  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
5399835 tgaaaaaagagatacatagtaagctatatatataccatcaatcaca 5399880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University