View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21085_high_8 (Length: 253)
Name: NF21085_high_8
Description: NF21085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21085_high_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 52386172 - 52385920
Alignment:
| Q |
1 |
ttggttccaccagaagtcctctcaggcatcgtcttcgaaccattggttggtaagttaacctctctacccggctaactgttttaacttcagctttgcggtt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52386172 |
ttggttccaacagaagtcctctcaggcatcgtcttcgaaccattggttggtaagttaacctctctacccggctaactgttttaacttcagcttcgcggtt |
52386073 |
T |
|
| Q |
101 |
ttccaaaccttgtttaacttgaggctcaggcttttcgggaagaatgacatgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52386072 |
ttccaaaccttgtttaacttgaggctcaggcttttcgggaagaatgacatgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaatta |
52385973 |
T |
|
| Q |
201 |
ttcatactctgtatgttgctgttcacatatgcctttcccgcttcatctctctc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52385972 |
ttcatactctgtatgttgctgttcacatatgcctttcccgcttcatctttctc |
52385920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 150 - 232
Target Start/End: Complemental strand, 7087895 - 7087813
Alignment:
| Q |
150 |
tgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacatatgc |
232 |
Q |
| |
|
||||| || ||||||||| |||| |||||||| || | ||| | ||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
7087895 |
tgaactccagggtctctttcattgattgaaccatgaaacatgagtgaattattgatactttgtatgttgctgttaacatatgc |
7087813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University