View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21085_low_12 (Length: 207)
Name: NF21085_low_12
Description: NF21085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21085_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 6 - 190
Target Start/End: Complemental strand, 29504827 - 29504643
Alignment:
| Q |
6 |
tggtgggtagataatactattttcgtcgtcgcaggttgcggcgttgaggccgggatttgcagcgtatacggcggcgaaggcggcagttgagactatgacg |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29504827 |
tggtgggaggataatactattttcgtcgtcgcaggttgcggcgttgaggccgggatttgcagcgtatacggcggcgaaggcggcagttgagactatgacg |
29504728 |
T |
|
| Q |
106 |
aagattttagcgaaggagttgaagggaactgggattacggcgaattgtgttgcaccgggaccgattgcgacggagatgttttttg |
190 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29504727 |
aagattttagcaaaggagttgaagggaactgggattacggcgaattgtgttgcaccgggaccgattgcgacggagatgttttttg |
29504643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 22 - 96
Target Start/End: Original strand, 8805626 - 8805700
Alignment:
| Q |
22 |
ctattttcgtcgtcgcaggttgcggcgttgaggccgggatttgcagcgtatacggcggcgaaggcggcagttgag |
96 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8805626 |
ctattttcgtcgtcgcaggttgcagcgttgaggccgagatttgcagcatatacggcggcgaaggcggcagttgag |
8805700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 100 - 188
Target Start/End: Complemental strand, 37622143 - 37622055
Alignment:
| Q |
100 |
atgacgaagattttagcgaaggagttgaagggaactgggattacggcgaattgtgttgcaccgggaccgattgcgacggagatgttttt |
188 |
Q |
| |
|
|||||||||||| | ||||||||| |||||||||| |||||||| || || ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
37622143 |
atgacgaagattctggcgaaggagctgaagggaacggggattactgcaaactgtgtggcaccgggaccgattgcaacggagatgttttt |
37622055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 100 - 188
Target Start/End: Complemental strand, 37628982 - 37628894
Alignment:
| Q |
100 |
atgacgaagattttagcgaaggagttgaagggaactgggattacggcgaattgtgttgcaccgggaccgattgcgacggagatgttttt |
188 |
Q |
| |
|
|||||||||||| | ||||||||| ||||||| ||||||||||| |||||||| || || |||||||||| ||| |||||| ||||||| |
|
|
| T |
37628982 |
atgacgaagattctggcgaaggagctgaaggggactgggattactgcgaattgcgtggcgccgggaccgactgcaacggagttgttttt |
37628894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University