View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21085_low_12 (Length: 207)

Name: NF21085_low_12
Description: NF21085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21085_low_12
NF21085_low_12
[»] chr1 (1 HSPs)
chr1 (6-190)||(29504643-29504827)
[»] chr5 (1 HSPs)
chr5 (22-96)||(8805626-8805700)
[»] chr7 (2 HSPs)
chr7 (100-188)||(37622055-37622143)
chr7 (100-188)||(37628894-37628982)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 6 - 190
Target Start/End: Complemental strand, 29504827 - 29504643
Alignment:
6 tggtgggtagataatactattttcgtcgtcgcaggttgcggcgttgaggccgggatttgcagcgtatacggcggcgaaggcggcagttgagactatgacg 105  Q
    |||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29504827 tggtgggaggataatactattttcgtcgtcgcaggttgcggcgttgaggccgggatttgcagcgtatacggcggcgaaggcggcagttgagactatgacg 29504728  T
106 aagattttagcgaaggagttgaagggaactgggattacggcgaattgtgttgcaccgggaccgattgcgacggagatgttttttg 190  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29504727 aagattttagcaaaggagttgaagggaactgggattacggcgaattgtgttgcaccgggaccgattgcgacggagatgttttttg 29504643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 22 - 96
Target Start/End: Original strand, 8805626 - 8805700
Alignment:
22 ctattttcgtcgtcgcaggttgcggcgttgaggccgggatttgcagcgtatacggcggcgaaggcggcagttgag 96  Q
    ||||||||||||||||||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||    
8805626 ctattttcgtcgtcgcaggttgcagcgttgaggccgagatttgcagcatatacggcggcgaaggcggcagttgag 8805700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 100 - 188
Target Start/End: Complemental strand, 37622143 - 37622055
Alignment:
100 atgacgaagattttagcgaaggagttgaagggaactgggattacggcgaattgtgttgcaccgggaccgattgcgacggagatgttttt 188  Q
    |||||||||||| | ||||||||| |||||||||| |||||||| || || ||||| ||||||||||||||||| ||||||||||||||    
37622143 atgacgaagattctggcgaaggagctgaagggaacggggattactgcaaactgtgtggcaccgggaccgattgcaacggagatgttttt 37622055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 100 - 188
Target Start/End: Complemental strand, 37628982 - 37628894
Alignment:
100 atgacgaagattttagcgaaggagttgaagggaactgggattacggcgaattgtgttgcaccgggaccgattgcgacggagatgttttt 188  Q
    |||||||||||| | ||||||||| ||||||| ||||||||||| |||||||| || || |||||||||| ||| |||||| |||||||    
37628982 atgacgaagattctggcgaaggagctgaaggggactgggattactgcgaattgcgtggcgccgggaccgactgcaacggagttgttttt 37628894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University