View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21086_high_13 (Length: 250)
Name: NF21086_high_13
Description: NF21086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21086_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 12 - 150
Target Start/End: Complemental strand, 7286827 - 7286689
Alignment:
| Q |
12 |
atgaatatattgaaacttcaaaaatatccacaaatatctcgaaaggtaatcaagaatgaagaagtacaaaattgaattataaaaatttaagaaaatgtgc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7286827 |
atgaatatattgaaacttcaaaaatatccacaaatatctcgaaaggtaatcaagaacgaagaagtagaaaattgaattataaaaatttaagaaaatgtgc |
7286728 |
T |
|
| Q |
112 |
ataaggtctgcaaatagagaccgaaattgaggtgttcaa |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7286727 |
ataaggtctgcaaatagagaccgaaattgaggtgttcaa |
7286689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 246
Target Start/End: Complemental strand, 7286488 - 7286430
Alignment:
| Q |
188 |
tctttccagtttttatatttactcttggttaattttagcttgccctcctttgtatatag |
246 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7286488 |
tctttccagtttttatattgactcttggttaattttagcttgccctcctttgtatatag |
7286430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 51
Target Start/End: Original strand, 8357372 - 8357411
Alignment:
| Q |
12 |
atgaatatattgaaacttcaaaaatatccacaaatatctc |
51 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8357372 |
atgaatatattgaaactgcaaaaatatccacaaatctctc |
8357411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University