View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21086_high_22 (Length: 216)
Name: NF21086_high_22
Description: NF21086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21086_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 21 - 195
Target Start/End: Complemental strand, 36272176 - 36272002
Alignment:
| Q |
21 |
ggaggttggggaggaggagaaaatgaagtagctatgggaagaggagaatatagtggttatggaggaggatgtggcggaggagaatatcaaatgcctcata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272176 |
ggaggttggggaggaggagaaaatgaagtagctatgggaagaggagaatatagtggttatggaggaggatgtggcggaggagaatatcaaatgcctcata |
36272077 |
T |
|
| Q |
121 |
tgagaggaggagaacaagaaggctttgaaaatcaagggccctgggaatgtccataacaattagagatatgaatgc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36272076 |
tgagaggaggagaacaagaaggctttgaaaatcaagggccctgggaatgtccataacaaatagagatatgaatgc |
36272002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University