View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21086_high_8 (Length: 396)
Name: NF21086_high_8
Description: NF21086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21086_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 343 - 381
Target Start/End: Original strand, 37322803 - 37322841
Alignment:
| Q |
343 |
aatgaattttgtaagtgaaaaatttagagtagatgaatg |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37322803 |
aatgaattttgtaagtgaaaaatttagagtagatgaatg |
37322841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University