View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21086_low_13 (Length: 250)

Name: NF21086_low_13
Description: NF21086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21086_low_13
NF21086_low_13
[»] chr4 (2 HSPs)
chr4 (12-150)||(7286689-7286827)
chr4 (188-246)||(7286430-7286488)
[»] chr7 (1 HSPs)
chr7 (12-51)||(8357372-8357411)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 12 - 150
Target Start/End: Complemental strand, 7286827 - 7286689
Alignment:
12 atgaatatattgaaacttcaaaaatatccacaaatatctcgaaaggtaatcaagaatgaagaagtacaaaattgaattataaaaatttaagaaaatgtgc 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||    
7286827 atgaatatattgaaacttcaaaaatatccacaaatatctcgaaaggtaatcaagaacgaagaagtagaaaattgaattataaaaatttaagaaaatgtgc 7286728  T
112 ataaggtctgcaaatagagaccgaaattgaggtgttcaa 150  Q
    |||||||||||||||||||||||||||||||||||||||    
7286727 ataaggtctgcaaatagagaccgaaattgaggtgttcaa 7286689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 246
Target Start/End: Complemental strand, 7286488 - 7286430
Alignment:
188 tctttccagtttttatatttactcttggttaattttagcttgccctcctttgtatatag 246  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
7286488 tctttccagtttttatattgactcttggttaattttagcttgccctcctttgtatatag 7286430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 51
Target Start/End: Original strand, 8357372 - 8357411
Alignment:
12 atgaatatattgaaacttcaaaaatatccacaaatatctc 51  Q
    ||||||||||||||||| ||||||||||||||||| ||||    
8357372 atgaatatattgaaactgcaaaaatatccacaaatctctc 8357411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University