View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21086_low_15 (Length: 247)
Name: NF21086_low_15
Description: NF21086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21086_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 7286181 - 7286027
Alignment:
| Q |
1 |
cgtttataacactgttcatttagactattaaatcactaagattgttattagcaaataagttatacctcttaacatattaaggtagaccaatatacccttc |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7286181 |
cgtttataacaccgttcatttagactattaaatcactaagattgttattagcaaataagttatacctcttaacatattaaggtagaccaatatacccttc |
7286082 |
T |
|
| Q |
101 |
gttttgcaaccaatagtgtcgcccaatatattagtaacaactacttctccatact |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7286081 |
gttttgcaaccaatagtgtcgcccaatatattagtaacaactacttctccatact |
7286027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 81
Target Start/End: Original strand, 16336229 - 16336299
Alignment:
| Q |
11 |
actgttcatttagactattaaatcactaagattgttattagcaaataagttatacctcttaacatattaag |
81 |
Q |
| |
|
|||||||| ||| | |||||||||| || ||||||||| ||||||||||||||||||||||| | |||||| |
|
|
| T |
16336229 |
actgttcaattaaaatattaaatcattatgattgttataagcaaataagttatacctcttaaaagattaag |
16336299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University