View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21086_low_20 (Length: 229)
Name: NF21086_low_20
Description: NF21086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21086_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 214
Target Start/End: Original strand, 29941744 - 29941938
Alignment:
| Q |
20 |
gtttggtctttatcggtggcgtaccagcgtgtgtggcgcaggtttagaaactcattaatgctggttgcattaaggtatttttgctcaagatgaaaggata |
119 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29941744 |
gtttggtctttaatggtggcgtagcagcgtgtgtggcgcaggtttagaaactcattaatgctggttgcattaaggtatctttgctcaagatgaaaggata |
29941843 |
T |
 |
| Q |
120 |
tcctgttggaaaattaatcttagtcagtggtttaagggctggatagtgtgactcaatgtgctttcttaattctagtatgtattgaggtctctgtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29941844 |
tcctgttggaaaattaatcttagtcagtggtttaagggttggatagtgtgactcaatgtgctttcttaattctagtatgtattgaggtctctgtg |
29941938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University