View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21086_low_8 (Length: 396)

Name: NF21086_low_8
Description: NF21086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21086_low_8
NF21086_low_8
[»] chr2 (1 HSPs)
chr2 (343-381)||(37322803-37322841)


Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 343 - 381
Target Start/End: Original strand, 37322803 - 37322841
Alignment:
343 aatgaattttgtaagtgaaaaatttagagtagatgaatg 381  Q
    |||||||||||||||||||||||||||||||||||||||    
37322803 aatgaattttgtaagtgaaaaatttagagtagatgaatg 37322841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University