View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21087_high_36 (Length: 311)

Name: NF21087_high_36
Description: NF21087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21087_high_36
NF21087_high_36
[»] chr1 (1 HSPs)
chr1 (192-302)||(15164777-15164887)


Alignment Details
Target: chr1 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 192 - 302
Target Start/End: Original strand, 15164777 - 15164887
Alignment:
192 cttttaaaatattttgttgatgaccatggtggttaaactgaaataataatacgcggtcgtttgtactagttatcgtcatccccttcaacggacactatat 291  Q
    ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
15164777 cttttaaaatattttgttgatcacaatggtggttaaactgaaataataatacgcggtcgtttgtgctagttatcgtcatccccttcaacggacactatat 15164876  T
292 ctccttcatct 302  Q
    |||||||||||    
15164877 ctccttcatct 15164887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University