View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21087_high_54 (Length: 245)
Name: NF21087_high_54
Description: NF21087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21087_high_54 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 2325530 - 2325760
Alignment:
| Q |
1 |
ataaatacctttatagacacattatatttccccgacaaaaacaagttgacgaatacgaggttttaagcatccattaattgatttcaatatttaaggatgt |
100 |
Q |
| |
|
||||||||||||||||||||| | | || |||| |||||||||||||||| || | |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2325530 |
ataaatacctttatagacacactct-ttgcccctacaaaaacaagttgaccaagaagaggttttaatcatccattaattgatttcaatatttaaggatgt |
2325628 |
T |
|
| Q |
101 |
cccatgcagcttgcttcagtcatgatgccaaatctgacttgcaaagaaatcttgcagatttccacccttgcgtttggggagattatttcattcaatatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2325629 |
cccatgcagcttgcttcagtcatgatgccaaatctgacttgcaaagaaatcttgcagatttccacccttgcgtttggggagattatttcattcaatatga |
2325728 |
T |
|
| Q |
201 |
ttcagaatctgtggtatgtacatattgctatt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2325729 |
ttcagaatctgtggtatgtacatattgctatt |
2325760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 141 - 217
Target Start/End: Complemental strand, 14268098 - 14268022
Alignment:
| Q |
141 |
gcaaagaaatcttgcagatttccacccttgcgtttggggagattatttcattcaatatgattcagaatctgtggtat |
217 |
Q |
| |
|
|||||||||||| ||||||| |||||| | ||||||| || |||||||||||||||| |||||||||| |||||| |
|
|
| T |
14268098 |
gcaaagaaatctggcagattatcaccctaacatttggggggaatatttcattcaatatgcttcagaatctatggtat |
14268022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 128 - 219
Target Start/End: Original strand, 25791651 - 25791742
Alignment:
| Q |
128 |
ccaaatctgacttgcaaagaaatcttgcagatttccacccttgcgtttggggagattatttcattcaatatgattcagaatctgtggtatgt |
219 |
Q |
| |
|
||||||||||||||| |||||| ||||||||| || ||| |||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
25791651 |
ccaaatctgacttgcgtagaaatgttgcagattatcaacctagcgtttggggagattatttcattcaatatgcttcagaatctatggtatgt |
25791742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 41352780 - 41352694
Alignment:
| Q |
130 |
aaatctgacttgcaaagaaatcttgcagatttccacccttgcgtttggggagattatttcattcaatatgattcagaatctgtggta |
216 |
Q |
| |
|
||||||||| | || |||||| |||| ||||| |||||| ||||||||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
41352780 |
aaatctgaccttcatagaaatgttgccgattttcaccctaacgtttggggagattatttccttcaatatgcttcagaatctatggta |
41352694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 128 - 216
Target Start/End: Original strand, 31158039 - 31158127
Alignment:
| Q |
128 |
ccaaatctgacttgcaaagaaatcttgcagatttccacccttgcgtttggggagattatttcattcaatatgattcagaatctgtggta |
216 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| | ||| |||||||||||||||||||| ||| ||||| ||| |||||| ||||| |
|
|
| T |
31158039 |
ccaaatctgacttgcatagaaatgttgcagattataaacctagcgtttggggagattatttccttcgatatgcttctgaatctatggta |
31158127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 216
Target Start/End: Original strand, 31198091 - 31198180
Alignment:
| Q |
127 |
gccaaatctgacttgcaaagaaatcttgcagatttccacccttgcgtttggggagattatttcattcaatatgattcagaatctgtggta |
216 |
Q |
| |
|
||||| |||||| |||| |||||| |||| ||||| || ||| |||||||||||||||||||| ||| |||| |||||||||| ||||| |
|
|
| T |
31198091 |
gccaattctgacatgcatagaaatgttgctgattttcaacctagcgtttggggagattatttccttcgctatgcttcagaatctatggta |
31198180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 141 - 216
Target Start/End: Original strand, 25831813 - 25831888
Alignment:
| Q |
141 |
gcaaagaaatcttgcagatttccacccttgcgtttggggagattatttcattcaatatgattcagaatctgtggta |
216 |
Q |
| |
|
|||||||||||||||||| || ||||| || |||||||| |||||||||||||||| |||||||||| ||||| |
|
|
| T |
25831813 |
gcaaagaaatcttgcagaatttcacccaaatgtctggggagaatatttcattcaatatgcttcagaatctatggta |
25831888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University