View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21087_high_56 (Length: 238)
Name: NF21087_high_56
Description: NF21087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21087_high_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 46464961 - 46464738
Alignment:
| Q |
1 |
tgttgaactttcaggtgtttgtggcagccttcaaaaacagaaaactcgaaattcctgagaatgcagaagaaatgcatgagatccatgaaaaagaaagagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46464961 |
tgttgaactttcaggtgtttgtggcagccttcaaaaacagaaaactcgaaattcctgagaatgcagaagaaatgcatgagatccatgaaaaagaaagagg |
46464862 |
T |
|
| Q |
101 |
agacagttatgaaatccttaagaggactgatcaattcaggttataatatataatgaaacatatttgaattttgattcatctaaataaatttaatgcaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
46464861 |
agacagttatgaaatccttaagaggactgatcaattcaggttataatatataacgaaacatatttgatttttaattcatctaaataaatttaatgcaaca |
46464762 |
T |
|
| Q |
201 |
tgatcgttgtatttactaattatt |
224 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
46464761 |
tgatcattgtatttactaattatt |
46464738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University