View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21087_low_18 (Length: 438)

Name: NF21087_low_18
Description: NF21087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21087_low_18
NF21087_low_18
[»] chr5 (2 HSPs)
chr5 (20-116)||(5039255-5039351)
chr5 (154-205)||(5039351-5039402)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 2e-47; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 20 - 116
Target Start/End: Original strand, 5039255 - 5039351
Alignment:
20 tacagttcatgaaaaagtagctgtttcttcaatattcattttgttactttcttatgaagtccacatacttagcaagactacaatagtgcaggtctat 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5039255 tacagttcatgaaaaagtagctgtttcttcaatattcattttgttactttcttatgaagtccacatacttagcaagactacaatagtgcaggtctat 5039351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 5039351 - 5039402
Alignment:
154 ttttgaaatttagaataaggtatgacctagatttgtttataaatcttttata 205  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||    
5039351 ttttgaaatttagaataaggtatgacctagatttgtttacaaatcttttata 5039402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University