View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21087_low_32 (Length: 336)
Name: NF21087_low_32
Description: NF21087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21087_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 17 - 314
Target Start/End: Original strand, 55381786 - 55382085
Alignment:
| Q |
17 |
cataggtggtggatgggggaaggacgagcgagagagggatgattttcttcgtttttaaatacatatccttaaataataaaatttaaaaacaatccc--ac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
55381786 |
cataggtggtggatgggggaaggacgagcgagagagggatgattttcttcgtttttaaatacatatccttaaataataaaatttaaaaacaatcccccac |
55381885 |
T |
 |
| Q |
115 |
aatttgttttaaagtcaaagaaatatgtttctaacaacttaataaatcaatgcataaacaattatgtcttttagacgacaaactagcatgagacaaatga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55381886 |
aatttgttttaaagtcaaagaaatatgtttctaacaacttaataaatcaatgcataaacaattatgtcttttagacgacaaactagcatgagacaaatga |
55381985 |
T |
 |
| Q |
215 |
gctatgatccctaaaaatatcaatgaggttatgacctctatagacataccagtagcaaacagattagaaaggccagggaaatattgctttgtgataaacg |
314 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55381986 |
gctatgatccctaaaaatatcaattaggttatgacctctatagacataccagtagcaaacagattagaaaggccagggaaatattgctttgtgataaacg |
55382085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University