View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21087_low_39 (Length: 312)
Name: NF21087_low_39
Description: NF21087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21087_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 140 - 297
Target Start/End: Original strand, 44160199 - 44160356
Alignment:
| Q |
140 |
atatcagtatgaaattagtctaattaccggcagacacgtcgaaaccacgggattctagctcacgaaattcttggcaaatggaaattgatgagagacaaca |
239 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44160199 |
atatcattatgaaattagtctaattaccggcagacacgtcgaaaccacgggattctagctcacgaaattcttggcaaatggaaattgatgagagacaaca |
44160298 |
T |
 |
| Q |
240 |
acaggtgccgatgcaatcacaagttttgctcccatcaattccataagtcttccttaat |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44160299 |
acaggtgccgatgcaatcacaagttttgctcccatcaattccataagtcttccttaat |
44160356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 34 - 138
Target Start/End: Original strand, 44160059 - 44160163
Alignment:
| Q |
34 |
gagattatggatagatatgtataggcattatgctaatactatttccgatccaaaccataaataaatcggtacatatatttaattaaaatttcgactaaat |
133 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44160059 |
gagattatggatagatatgtataggcactatgctaatactctttccgatctaaaccataaataaatcggtacatatatttaattaaaatttcgactaaat |
44160158 |
T |
 |
| Q |
134 |
acatg |
138 |
Q |
| |
|
||||| |
|
|
| T |
44160159 |
acatg |
44160163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University