View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21087_low_40 (Length: 311)
Name: NF21087_low_40
Description: NF21087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21087_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 192 - 302
Target Start/End: Original strand, 15164777 - 15164887
Alignment:
| Q |
192 |
cttttaaaatattttgttgatgaccatggtggttaaactgaaataataatacgcggtcgtttgtactagttatcgtcatccccttcaacggacactatat |
291 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15164777 |
cttttaaaatattttgttgatcacaatggtggttaaactgaaataataatacgcggtcgtttgtgctagttatcgtcatccccttcaacggacactatat |
15164876 |
T |
 |
| Q |
292 |
ctccttcatct |
302 |
Q |
| |
|
||||||||||| |
|
|
| T |
15164877 |
ctccttcatct |
15164887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University