View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21087_low_49 (Length: 267)
Name: NF21087_low_49
Description: NF21087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21087_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 29 - 248
Target Start/End: Original strand, 52491072 - 52491290
Alignment:
| Q |
29 |
aacgggaagagaacacacattgtactttgaacgaaggtcaccggagagaggtgcgctaatcaacacacgacgaacgtttggtggggcggtgaaatgaacc |
128 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
52491072 |
aacgggaagagaacgcacgatgtactttgaacgaaggtcaccagagagaggtgcgctaatcaacacacgacggacgtttgatggggcggtgaaatgaacc |
52491171 |
T |
 |
| Q |
129 |
ttgcggctcttgtgacggctgcttgaaagaagaagaaacatggatgaatgaattgcagatctgaannnnnnnncgtattactcttctatgaaatcgtgag |
228 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52491172 |
ttgcggctcttgtgacagctgcttgaaagaagaagaaacgtggatgaatgaattgcagatctgaa-tttttttcgtattactcttctatgaaatcgtgag |
52491270 |
T |
 |
| Q |
229 |
gaagaataatggaagcaaag |
248 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52491271 |
gaagaataatggaagcaaag |
52491290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 29 - 156
Target Start/End: Complemental strand, 5404332 - 5404205
Alignment:
| Q |
29 |
aacgggaagagaacacacattgtactttgaacgaaggtcaccggagagaggtgcgctaatcaacacacgacgaacgtttggtggggcggtgaaatgaacc |
128 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||||||||| ||||||||||| |||||||||||||| ||| ||| |||||||||||||||| || |
|
|
| T |
5404332 |
aacgggaagagaacgcacgttgtactttgaacggaggtcaccggaaagaggtgcgctcatcaacacacgacggacgcttgatggggcggtgaaatgagcc |
5404233 |
T |
 |
| Q |
129 |
ttgcggctcttgtgacggctgcttgaaa |
156 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
5404232 |
ttgcggctcttgcgacggctgcttgaaa |
5404205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 87 - 193
Target Start/End: Complemental strand, 21946304 - 21946198
Alignment:
| Q |
87 |
atcaacacacgacgaacgtttggtggggcggtgaaatgaaccttgcggctcttgtgacggctgcttgaaagaagaagaaacatggatgaatgaattgcag |
186 |
Q |
| |
|
|||||||||||||| |||||||||| |||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21946304 |
atcaacacacgacggacgtttggtgtggcggtaaaatgaaccttgcggctcttgcgacggatgcttgaaagaagaagaaacatggctgaatgaattgcat |
21946205 |
T |
 |
| Q |
187 |
atctgaa |
193 |
Q |
| |
|
||||||| |
|
|
| T |
21946204 |
atctgaa |
21946198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 29 - 193
Target Start/End: Original strand, 30927076 - 30927232
Alignment:
| Q |
29 |
aacgggaagagaacacacattgtactttgaacgaaggtcaccggagagaggtgcgctaatcaacacacgacgaacgtttggtggggcggtgaaatgaacc |
128 |
Q |
| |
|
||||||||||||| ||| |||||||||||| |||||||||||||||||||| |||| |||||||||||||| || || | | ||| | || |
|
|
| T |
30927076 |
aacgggaagagaatgcacgttgtactttgaaagaaggtcaccggagagaggttcgctcatcaacacacgacggacttt--gaaagaaggtca------cc |
30927167 |
T |
 |
| Q |
129 |
ttgcggctcttgtgacggctgcttgaaagaagaagaaacatggatgaatgaattgcagatctgaa |
193 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30927168 |
ttgcggctcttccgacggttgcttgaaagaagaagaaacatggatgaatgaattgcatatctgaa |
30927232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University