View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21087_low_54 (Length: 253)
Name: NF21087_low_54
Description: NF21087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21087_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 240
Target Start/End: Complemental strand, 10703403 - 10703179
Alignment:
| Q |
16 |
ataataattataatacattcttttataattagctttttcaaccattgtaacatagcaaagtcatcgatgtannnnnnnncctttgtgaaactgacttctg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
10703403 |
ataataattataatacattcttttataattagctttttcaacctttgtaacatagcaaagtcatcaatgtattttttttcctttgtgaaactgacttctg |
10703304 |
T |
|
| Q |
116 |
attgatgttttttcgtgagcgattaaaaatatttttaccaatgacatgccaacatatttatgatattttaactatgttttagaggagttgttcatggttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10703303 |
attgatgttttttcgtgagcgattaaaaatatttttaccaatgacatgccaacatatttatgatattttaactatgttttagaggagttgttcatggttt |
10703204 |
T |
|
| Q |
216 |
aagggacattaattttatatttttt |
240 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
10703203 |
aagggacattaattttgtatttttt |
10703179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 180 - 225
Target Start/End: Complemental strand, 26472918 - 26472873
Alignment:
| Q |
180 |
attttaactatgttttagaggagttgttcatggtttaagggacatt |
225 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
26472918 |
attttaaagatgttttagaggagttgatcatggtttatgggacatt |
26472873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University