View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21088_high_6 (Length: 272)
Name: NF21088_high_6
Description: NF21088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21088_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 25 - 260
Target Start/End: Original strand, 34524044 - 34524276
Alignment:
| Q |
25 |
atcaaatgcgttaaataacatgggacaataggagtaataaataattattaaaaaatatttatattttctctttcttaggatcacgagtttcttgttcaat |
124 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34524044 |
atcaaatgcgataaataacatgggacaataggagtaatatataattattaaaaaatatttatattttctctttcttaggatcacgagtttcttgttcaat |
34524143 |
T |
|
| Q |
125 |
tcaggacaaaatcagatgaccttgtactagtagtattttggaaggcaatgaattgatggggagcgataacgccatattcctaaggtaattattcactcac |
224 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
34524144 |
tcaggacaaaatcagatgaccttgtac---tagtattttggaaggcaatgaattgatggggagcggtaacgccatattcctaaggtaattactcactcac |
34524240 |
T |
|
| Q |
225 |
ttattatgaatattgtagaagtttacccacattatg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34524241 |
ttattatgaatattgtagaagtttacccacattatg |
34524276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University