View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21088_high_7 (Length: 250)

Name: NF21088_high_7
Description: NF21088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21088_high_7
NF21088_high_7
[»] chr4 (6 HSPs)
chr4 (18-222)||(16591987-16592191)
chr4 (47-182)||(16602477-16602612)
chr4 (113-189)||(16591900-16591976)
chr4 (112-182)||(35335546-35335616)
chr4 (113-182)||(35335415-35335484)
chr4 (113-181)||(35335679-35335747)
[»] chr3 (1 HSPs)
chr3 (132-192)||(3175705-3175765)
[»] chr1 (1 HSPs)
chr1 (132-194)||(24541083-24541145)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 16592191 - 16591987
Alignment:
18 ataaacaacaccttcaacagctatttgggcaggggcatgaggcggaggatgttgttgatgaacagggggatgggcaggagggtggtgatggtgacgatgg 117  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
16592191 ataaacaacaccttcaacagctatttgggcaggggcatgagccggaggatgttgttgatgaacagggggatgggcaggagggtggtgatgatgacgatgg 16592092  T
118 gttggaggttgaacaggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagctgggtgacgaggttggtgatgacgaataggggcat 217  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||    
16592091 gttggaggttgaacaggggcatgagcaggagggtgttgatggtggtgatgggttggaggtttaacagggtgacgaggttggtgatgatgaataggggcat 16591992  T
218 gagaa 222  Q
    |||||    
16591991 gagaa 16591987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 47 - 182
Target Start/End: Complemental strand, 16602612 - 16602477
Alignment:
47 caggggcatgaggcggaggatgttgttgatgaacagggggatgggcaggagggtggtgatggtgacgatgggttggaggttgaacaggggcatgagcagg 146  Q
    |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16602612 caggggcatgagccggaggatgttgttgatgaatagggggatgggcaggagggtggtgatggtgacgatgggttggaggttgaacaggggcatgagcagg 16602513  T
147 agcgtgttgatggtggtgatgggttggaggtttagc 182  Q
    || ||||||||||| | |||||||||||||||||||    
16602512 agggtgttgatggtagggatgggttggaggtttagc 16602477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 113 - 189
Target Start/End: Complemental strand, 16591976 - 16591900
Alignment:
113 gatgggttggaggttgaacaggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagctgggtga 189  Q
    |||||| || |||||||| ||||||||||||||||| |||||| ||||||||| |||||||||||||||| ||||||    
16591976 gatgggatgaaggttgaagaggggcatgagcaggagggtgttggtggtggtgacgggttggaggtttagcagggtga 16591900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 112 - 182
Target Start/End: Original strand, 35335546 - 35335616
Alignment:
112 cgatgggttggaggttgaacaggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagc 182  Q
    ||||| ||||||||||||| ||||| ||||||||||| |||||||||  ||||||||||||||||||||||    
35335546 cgatgtgttggaggttgaataggggaatgagcaggagtgtgttgatgacggtgatgggttggaggtttagc 35335616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 113 - 182
Target Start/End: Original strand, 35335415 - 35335484
Alignment:
113 gatgggttggaggttgaacaggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagc 182  Q
    |||| ||||||||||||||||||| ||||| ||||| |||||||||| | ||||||||||||||||||||    
35335415 gatgcgttggaggttgaacaggggaatgagtaggagggtgttgatggcgatgatgggttggaggtttagc 35335484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 113 - 181
Target Start/End: Original strand, 35335679 - 35335747
Alignment:
113 gatgggttggaggttgaacaggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttag 181  Q
    |||| |||||||||||||||||||| ||||||||||  |||||||| ||| |||||||||| |||||||    
35335679 gatgtgttggaggttgaacaggggcgtgagcaggaggatgttgatgatggcgatgggttgggggtttag 35335747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 192
Target Start/End: Original strand, 3175705 - 3175765
Alignment:
132 aggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagctgggtgacga 192  Q
    ||||||||||||||||| ||| ||||| || ||||||||||| ||||| || |||||||||    
3175705 aggggcatgagcaggagagtgatgatgatgatgatgggttgggggttttgcagggtgacga 3175765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 194
Target Start/End: Original strand, 24541083 - 24541145
Alignment:
132 aggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagctgggtgacgagg 194  Q
    ||||| ||||||||||| |||||| || || ||||| ||||| ||||| ||||||||||||||    
24541083 aggggaatgagcaggagagtgttgttgatgatgatgagttgggggttttgctgggtgacgagg 24541145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University