View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21088_high_7 (Length: 250)
Name: NF21088_high_7
Description: NF21088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21088_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 16592191 - 16591987
Alignment:
| Q |
18 |
ataaacaacaccttcaacagctatttgggcaggggcatgaggcggaggatgttgttgatgaacagggggatgggcaggagggtggtgatggtgacgatgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16592191 |
ataaacaacaccttcaacagctatttgggcaggggcatgagccggaggatgttgttgatgaacagggggatgggcaggagggtggtgatgatgacgatgg |
16592092 |
T |
|
| Q |
118 |
gttggaggttgaacaggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagctgggtgacgaggttggtgatgacgaataggggcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
16592091 |
gttggaggttgaacaggggcatgagcaggagggtgttgatggtggtgatgggttggaggtttaacagggtgacgaggttggtgatgatgaataggggcat |
16591992 |
T |
|
| Q |
218 |
gagaa |
222 |
Q |
| |
|
||||| |
|
|
| T |
16591991 |
gagaa |
16591987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 47 - 182
Target Start/End: Complemental strand, 16602612 - 16602477
Alignment:
| Q |
47 |
caggggcatgaggcggaggatgttgttgatgaacagggggatgggcaggagggtggtgatggtgacgatgggttggaggttgaacaggggcatgagcagg |
146 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16602612 |
caggggcatgagccggaggatgttgttgatgaatagggggatgggcaggagggtggtgatggtgacgatgggttggaggttgaacaggggcatgagcagg |
16602513 |
T |
|
| Q |
147 |
agcgtgttgatggtggtgatgggttggaggtttagc |
182 |
Q |
| |
|
|| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
16602512 |
agggtgttgatggtagggatgggttggaggtttagc |
16602477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 113 - 189
Target Start/End: Complemental strand, 16591976 - 16591900
Alignment:
| Q |
113 |
gatgggttggaggttgaacaggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagctgggtga |
189 |
Q |
| |
|
|||||| || |||||||| ||||||||||||||||| |||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
16591976 |
gatgggatgaaggttgaagaggggcatgagcaggagggtgttggtggtggtgacgggttggaggtttagcagggtga |
16591900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 112 - 182
Target Start/End: Original strand, 35335546 - 35335616
Alignment:
| Q |
112 |
cgatgggttggaggttgaacaggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagc |
182 |
Q |
| |
|
||||| ||||||||||||| ||||| ||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
35335546 |
cgatgtgttggaggttgaataggggaatgagcaggagtgtgttgatgacggtgatgggttggaggtttagc |
35335616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 113 - 182
Target Start/End: Original strand, 35335415 - 35335484
Alignment:
| Q |
113 |
gatgggttggaggttgaacaggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagc |
182 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| ||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
35335415 |
gatgcgttggaggttgaacaggggaatgagtaggagggtgttgatggcgatgatgggttggaggtttagc |
35335484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 113 - 181
Target Start/End: Original strand, 35335679 - 35335747
Alignment:
| Q |
113 |
gatgggttggaggttgaacaggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttag |
181 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| |||||||| ||| |||||||||| ||||||| |
|
|
| T |
35335679 |
gatgtgttggaggttgaacaggggcgtgagcaggaggatgttgatgatggcgatgggttgggggtttag |
35335747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 192
Target Start/End: Original strand, 3175705 - 3175765
Alignment:
| Q |
132 |
aggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagctgggtgacga |
192 |
Q |
| |
|
||||||||||||||||| ||| ||||| || ||||||||||| ||||| || ||||||||| |
|
|
| T |
3175705 |
aggggcatgagcaggagagtgatgatgatgatgatgggttgggggttttgcagggtgacga |
3175765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 194
Target Start/End: Original strand, 24541083 - 24541145
Alignment:
| Q |
132 |
aggggcatgagcaggagcgtgttgatggtggtgatgggttggaggtttagctgggtgacgagg |
194 |
Q |
| |
|
||||| ||||||||||| |||||| || || ||||| ||||| ||||| |||||||||||||| |
|
|
| T |
24541083 |
aggggaatgagcaggagagtgttgttgatgatgatgagttgggggttttgctgggtgacgagg |
24541145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University