View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21088_low_8 (Length: 249)

Name: NF21088_low_8
Description: NF21088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21088_low_8
NF21088_low_8
[»] chr3 (1 HSPs)
chr3 (12-234)||(46945539-46945760)


Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 12 - 234
Target Start/End: Complemental strand, 46945760 - 46945539
Alignment:
12 aattctactgattcaaaaacaagcaaaaatacaagtagaatcaaactcattttattctccgaaaaaatatgaaactcaatttgagccctg-nnnnnnnnn 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||              
46945760 aattctactgattcaaaaacaagcaaaaatacaagtagaatcaaactcattttattctccgaaaaaatatgaaactcaatttgagccctgaaaaaaaaaa 46945661  T
111 catttactactgttagtgcctagnnnnnnnntcaagacaacttagtctttaattgaaccactatcaaaaaatggacaattaggccccctaacaataatta 210  Q
    | |||||||||||||||||||||        |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
46945660 cttttactactgttagtgcctag-aaaaaaatcaagacaacttagtc-ttaattgaaccactatcaaaaaatggacaattaggtcccctaacaataatta 46945563  T
211 aaagtgagatagtttgatctcttt 234  Q
    ||||||||||||||||||||||||    
46945562 aaagtgagatagtttgatctcttt 46945539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University