View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21088_low_9 (Length: 219)
Name: NF21088_low_9
Description: NF21088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21088_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 1e-27; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 120 - 202
Target Start/End: Original strand, 21216027 - 21216109
Alignment:
| Q |
120 |
acttttccagcgaaaaggtttgccgaatttcagttgttgcaacaatcgattcaatcttaacttcttatggtgatagctgagaa |
202 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21216027 |
acttttccagcgaaaaagtttgccgaattctagttgttgcaaccatcgattcaatcttaacttcttatggtgatagttgagaa |
21216109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 120 - 202
Target Start/End: Original strand, 22912778 - 22912859
Alignment:
| Q |
120 |
acttttccagcgaaaaggtttgccgaatttcagttgttgcaacaatcgattcaatcttaacttcttatggtgatagctgagaa |
202 |
Q |
| |
|
||||||| ||| ||| ||||||||||||| ||||||||||||| |||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
22912778 |
acttttctagcaaaatggtttgccgaattccagttgttgcaaccatcgattcaatctt-acttcttctggtggtagctgagaa |
22912859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 43
Target Start/End: Original strand, 21215760 - 21215792
Alignment:
| Q |
11 |
gaagaatatcaaagtttaaacaacaatgacagt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21215760 |
gaagaatatcaaagtttaaacaacaatgacagt |
21215792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 120 - 202
Target Start/End: Original strand, 15403911 - 15403991
Alignment:
| Q |
120 |
acttttccagcgaaaaggtttgccgaatttcagttgttgcaacaatcgattcaatcttaacttcttatggtgatagctgagaa |
202 |
Q |
| |
|
|||||| |||||||||||| |||| |||| ||||||||||||| |||||||||||| | ||||||| ||||| |||||||||| |
|
|
| T |
15403911 |
actttttcagcgaaaaggtctgcc-aattccagttgttgcaaccatcgattcaatcat-acttcttttggtggtagctgagaa |
15403991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 10625288 - 10625230
Alignment:
| Q |
120 |
acttttccagcgaaaaggtttgccgaatttcagttgttgcaacaatcgattcaatctta |
178 |
Q |
| |
|
||||||||||| |||||||||||| |||| | |||||||||| ||||||||||||||| |
|
|
| T |
10625288 |
acttttccagcaaaaaggtttgcctaattctaattgttgcaaccatcgattcaatctta |
10625230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 160
Target Start/End: Original strand, 53245941 - 53245981
Alignment:
| Q |
120 |
acttttccagcgaaaaggtttgccgaatttcagttgttgca |
160 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
53245941 |
acttttccaacaaaaaggtttgccgaattccagttgttgca |
53245981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University