View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2108_high_14 (Length: 249)
Name: NF2108_high_14
Description: NF2108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2108_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 6 - 239
Target Start/End: Original strand, 15689057 - 15689290
Alignment:
| Q |
6 |
gatattgataaccatgttatcggtcgataaaacaggcatatttactgtctcaattggtattaggagcctttaatctagtgcaggccatgactgctaaata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15689057 |
gatattgataaccatgttatcggtcgataaaacaggcatattgactgtctcaattggtattaggagcctttaatctagtgcaggccatgactgctaaata |
15689156 |
T |
 |
| Q |
106 |
caaaccaaagaaaacgtctcaattggtatcaggagcctttaatctagtgccatgactgctaaatacaaaccgaagtaaattttgagtgttatgggagttg |
205 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15689157 |
caaactgaagaaaacgtctcaattggtatcaggagcctttaatctagtgccatgactgctaaatacaaaccgaagtaaattttgagtgttatgggagttg |
15689256 |
T |
 |
| Q |
206 |
actaaaagatggaaatgagtttatgcttcctatg |
239 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
15689257 |
agtaaaagatggaaatgagtttatgcttcctatg |
15689290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 105
Target Start/End: Original strand, 15688978 - 15689006
Alignment:
| Q |
77 |
aatctagtgcaggccatgactgctaaata |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15688978 |
aatctagtgcaggccatgactgctaaata |
15689006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University