View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2108_low_14 (Length: 264)

Name: NF2108_low_14
Description: NF2108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2108_low_14
NF2108_low_14
[»] chr1 (1 HSPs)
chr1 (20-249)||(11952905-11953134)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 249
Target Start/End: Complemental strand, 11953134 - 11952905
Alignment:
20 aaccgcgtggcagtgcgcagttggaactgatgcgtctgagactaaacagcacagcgcggaggaaggacagcgactctgagtgatatgcgcagaaacgaca 119  Q
    |||||||||||| ||||||| ||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
11953134 aaccgcgtggcaatgcgcaggtggaactgatgcgtctgggactaaacggcacagcacggaggaaggacagcgactctgagtgatatgcgcagaaaggaca 11953035  T
120 gagtagagaatagattagggttccatgctggtagaggaaacaggaaacaattttacgactagggttcagatcttgtatagttttttgttatagttctcaa 219  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
11953034 gagtagagaatggattagggttccatgctggtagaggaaacaggaaacaattttacgactagggttcagatcttgtatagttttttgttatagttctcga 11952935  T
220 aaaagggctgggttgggaattcggaacaat 249  Q
    ||| ||||| ||||||||||| ||||||||    
11952934 aaatgggctcggttgggaattgggaacaat 11952905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University