View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2108_low_18 (Length: 240)
Name: NF2108_low_18
Description: NF2108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2108_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 2036349 - 2036127
Alignment:
| Q |
17 |
gttagttcgtaaaatatcttgaaattattacacaatgagttgtgattggatgcatgtgnnnnnnnnngttttcattgatagtgcatacctatttctcatt |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
2036349 |
gttagttcgtaaaatatctcgaaattattacacaatgagttgtgattgaatgcatgtgaaaaaaaa-gttttcattgatagtgaatacctatttctcatt |
2036251 |
T |
 |
| Q |
117 |
tcacattcaagtgcatagtatatgtataatgtagtaactactaagtaatacattgctcacacaatcatgttttatatcaatagtaattactaattgaaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2036250 |
tcacattcaagtgcatagtatatgtataatgtagtacctactaagtaatacattgctcacacaatcatgttttatatcaatagtaattactaattgaaca |
2036151 |
T |
 |
| Q |
217 |
aggcaatgatagtataaatataca |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2036150 |
aggcaatgatagtataaatataca |
2036127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University