View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2108_low_20 (Length: 237)
Name: NF2108_low_20
Description: NF2108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2108_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 31408591 - 31408813
Alignment:
| Q |
1 |
agcagctaccaccataacatattgcaccttgcaagcccagcccatgtccctttcagctcaaattgcataattaattatcatcatactacaatattcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31408591 |
agcagctaccaccataacatattgcaccttgcaagcccagcccatgtccctttcggctcaaattgcataattaattatcatcatactacaatattcttca |
31408690 |
T |
|
| Q |
101 |
tattaatttgtccaacaataatgcaattacagtgttggtgattgtgac-aaaaaatagtacatgtaatttgaacagtaaaattgccaagtatacaagcat |
199 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31408691 |
tattaatctgtccaacaataatgcaattacagtgttggtgattgtgacaaaaaaatagtacatgtaatttgaacagtaaaattgccaagtatacaagcat |
31408790 |
T |
|
| Q |
200 |
gatcctttacataagaagtttgt |
222 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
31408791 |
gatccattacataagaagtttgt |
31408813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University