View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2108_low_22 (Length: 227)
Name: NF2108_low_22
Description: NF2108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2108_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 74 - 216
Target Start/End: Complemental strand, 2035974 - 2035832
Alignment:
| Q |
74 |
cttgattggattatgcagagataaatttgatatgtgagaaactaagtgcctcagttgggttgggaattgtggacattgattcaaagttaagggattctcc |
173 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2035974 |
cttgattggattctgcagagataaatttgatatgtgagaaactaagtgcctcagttgggttgggaattgtggacattgattcaaagttaagggattctcc |
2035875 |
T |
|
| Q |
174 |
tatttggacttcatatgcccctgatatatacactaatattcat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2035874 |
tatttggacttcatatgcccctgatatatacactaatattcat |
2035832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 209
Target Start/End: Original strand, 49889562 - 49889631
Alignment:
| Q |
140 |
ttgtggacattgattcaaagttaagggattctcctatttggacttcatatgcccctgatatatacactaa |
209 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||| ||||||| | | ||||||||||||||||||||||| |
|
|
| T |
49889562 |
ttgtggacatcgataaaaagttaatggattctcaaatttggagtgcttatgcccctgatatatacactaa |
49889631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University