View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2108_low_26 (Length: 207)
Name: NF2108_low_26
Description: NF2108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2108_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 100 - 189
Target Start/End: Complemental strand, 951347 - 951258
Alignment:
| Q |
100 |
atcacatctttcttcttcccaacttttttcactatttccaacaaaattcattttccttagtcatgaggatggtcacgctaatgtttgatc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
951347 |
atcacatctttcttcttcccaacttttttcactatttccaacaaaattcattttccttagtcatgaggatggtcatgctaatgtttgatc |
951258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 108
Target Start/End: Complemental strand, 951846 - 951809
Alignment:
| Q |
71 |
aaaagacgcgaaccattgcttccctcaccatcacatct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
951846 |
aaaagacgcgaaccattgcttccctcaccatcacatct |
951809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 951918 - 951874
Alignment:
| Q |
16 |
atgaagacggtgaacttttttagtgtgaaattaatgtactcttgt |
60 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
951918 |
atgaagacggtgaacttttctcgtgtgaaattaatgtactcttgt |
951874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University