View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21090_low_1 (Length: 585)
Name: NF21090_low_1
Description: NF21090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21090_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 7327397 - 7327219
Alignment:
| Q |
18 |
tgcaaatgaggtgcgtttgcaagctgtggaattctctggtcgttgatcctaaaatgatgaagaagcactttcacagattttccactgaagtcgctgatct |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7327397 |
tgcaaatgaggtgcgtttgcaagctgcggaaatctctggtcgttgatcctaaaatgatgaagaagcactttcacagattttccactgaagtcgctgatct |
7327298 |
T |
 |
| Q |
118 |
aacttctaaggccaagaaacacatcaatgcttttaaatcgcagcatccagaacaagatactggtgttgaagatgctgct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7327297 |
aacttctaaggccaagaaacacatcaatgcttttaaatcgcagcatccagaacaagatactggtgttgaagatgctgct |
7327219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 226 - 292
Target Start/End: Complemental strand, 7327189 - 7327123
Alignment:
| Q |
226 |
cgacgatgctactccagataaagacaaattgaaacaatggttgatgattgacgttgatcatttggat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7327189 |
cgacgatgctactccagataaagacaaattgaaacaatggttgatgattgacgttgatcatttggat |
7327123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University