View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21091_high_3 (Length: 300)
Name: NF21091_high_3
Description: NF21091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21091_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 101 - 284
Target Start/End: Complemental strand, 5501588 - 5501405
Alignment:
| Q |
101 |
ggacaaccaactatttctcaaagacgttaccgtagataagttacacagaggcttcatccatgatgaaatataggtccaacattcgttatggaaaaattat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5501588 |
ggacaaccaactatttctcaaagacgttaccgtagataagttacatagaggcttcatccatgatgaaatataggtccaacattcgttatggaaaaattat |
5501489 |
T |
 |
| Q |
201 |
tattcgggatttccaaaagcttcagacaaagaaagatgtcaaacattgtagggtttggacaaatgttgcgggacagattccatg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5501488 |
tattcgggatttccaaaagcttcagacaaagaaagatgtcaagcattgtagggtttggacaaatggtgcgggacagattccatg |
5501405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University