View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21092_low_1 (Length: 470)
Name: NF21092_low_1
Description: NF21092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21092_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 290
Target Start/End: Complemental strand, 24125520 - 24125247
Alignment:
| Q |
17 |
tgctctctatgggacacatgtggaatcaactttccacttgtttttctttctgaaaatggttccgttgaagnnnnnnntcatacatcatgtacctattacg |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
24125520 |
tgctctctataggacacatgtggaatcaactttccacttgtttttctttctgaaaatggttccgttgaagaaaaaaatcatacatcatgtacctattatg |
24125421 |
T |
|
| Q |
117 |
agtggaaattggccttgattttatattggagctaatagagtagggcgatggggggtgagtctaggtcagactatctctggaaacaaggacctagtttttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24125420 |
agtggaaattggccttgattttatattggagctaatagagtagggcgatggggggtgagtctaggtcagactatccctggaaacaaggacctagtttttg |
24125321 |
T |
|
| Q |
217 |
tcaaccccacctgagagtgttcacttttcttattttgaaagttttcaaatgttcttttcagttaggttgcttat |
290 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
24125320 |
tcaaccccacccgggagtgttcacttttcttattttgaaagtttccaaatgttcttttcagttagattgcttat |
24125247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 406 - 453
Target Start/End: Complemental strand, 24124471 - 24124424
Alignment:
| Q |
406 |
ttatcttcacagtttggtatgcaatttatgcatggctacggatggtgt |
453 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24124471 |
ttatcttcacagtttggtatgcaatttatgcatggctacggatggtgt |
24124424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 315 - 361
Target Start/End: Complemental strand, 24124546 - 24124500
Alignment:
| Q |
315 |
tttggcgactcttgtatcatatctcttctttgttttatatatataat |
361 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24124546 |
tttggcgactcttgtatcgtatctcttctttgttttatatatataat |
24124500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 5e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 180 - 290
Target Start/End: Original strand, 45163326 - 45163435
Alignment:
| Q |
180 |
ggtcagactatctctggaaacaaggacctagtttttgtcaaccccacctgagagtgttcacttttcttattttgaaagttttcaaatgttcttttcagtt |
279 |
Q |
| |
|
||||| |||||| ||| || ||||||||| ||| ||| ||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| || |
|
|
| T |
45163326 |
ggtcaaactatccctgaaagcaaggacctggttcttgccaaccccacctaggagtgttcactttacttattttgaaagttttcaaat-ttcttttcaatt |
45163424 |
T |
|
| Q |
280 |
aggttgcttat |
290 |
Q |
| |
|
| | ||||||| |
|
|
| T |
45163425 |
acgctgcttat |
45163435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 45163235 - 45163287
Alignment:
| Q |
26 |
tgggacacatgtggaatcaactttccacttgtttttctttctgaaaatggttcc |
79 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45163235 |
tgggacacatgtg-aatcaactttccacttgttcttctttctgaaaatggttcc |
45163287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University