View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21093_high_23 (Length: 265)
Name: NF21093_high_23
Description: NF21093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21093_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 2 - 249
Target Start/End: Complemental strand, 35170073 - 35169829
Alignment:
| Q |
2 |
cgagtgaggcgatgagtttgagagattgttttctgatggaaggttttagttcggagtgaatgtcgagaatgcaagagaggaatggggagatggaatgtgg |
101 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35170073 |
cgagtgaagcgatgagtttgagagattgttttctgatggaaggttttagttcggagtgaatgtcgagaatgcaagagaggaatggggagatggaatgtgg |
35169974 |
T |
 |
| Q |
102 |
agttaatgagtggaggattgtttcgagctctttggttccgatatcgtgtgtgtctcgatctccaactttgtttaatgcattgtgtactctttgcttcatc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35169973 |
agttaatgagtggaggattgtttcgagctctttggttccgatatcgtgtgtgtctcgatctccaactttgtttaatgcattgtgtactctttgcttcatc |
35169874 |
T |
 |
| Q |
202 |
tcgaaattactactactcagcttgttgttggtcttcattgttattgct |
249 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35169873 |
tcgaaattac---tactcagcttgttgttggtcttcattgttattgct |
35169829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University