View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21093_high_24 (Length: 255)
Name: NF21093_high_24
Description: NF21093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21093_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 8e-42; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 10 - 96
Target Start/End: Original strand, 12276342 - 12276428
Alignment:
| Q |
10 |
agaagaaggcaatggagcactgtcctgttacaaagctacaacgctgaagaatttctttttggtgctagcaattgtacttatgaattt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12276342 |
agaagaaggcaatggagcactgtcctgttacaaagctacaacgctgaagaatttctttttggtgctagcaattgtacttatgaattt |
12276428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 12276470 - 12276522
Alignment:
| Q |
102 |
ttgtctcatgttgtttctttgattctcctcaagtccatcagtctcaatttctt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12276470 |
ttgtctcatgttgtttctttgattctcctcaagtccatcagtctcaatttctt |
12276522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 175 - 240
Target Start/End: Original strand, 12276517 - 12276586
Alignment:
| Q |
175 |
tttcttggcttctttcctaagaaagtcttcatgtaggcgcctagcaacatgtc----catcacaaatttt |
240 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12276517 |
tttcttggcttctttcctatgaaagtcttcatgtaggcgcctagcaacatgtctgtccatcacaaatttt |
12276586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University