View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21093_high_27 (Length: 239)
Name: NF21093_high_27
Description: NF21093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21093_high_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 34938369 - 34938512
Alignment:
| Q |
1 |
tcagttcttgattcctcnnnnnnnncatggtgatttggctcttaccgcgcagtttcatcttaagcttaatgatgttgttcatgttgagggtcaactttct |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34938369 |
tcagttcttgattcctcttgtttttcatggtgatttggctcttaccgcgcagtttcatcttaagcttaatgatgttgttcatgttgagggtcaactttct |
34938468 |
T |
|
| Q |
101 |
actgaagatgatcaaatcaaacttgataaacctcaacaatatca |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34938469 |
actgaagatgatcaaatcaaacttgataaacctcaacaatatca |
34938512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University