View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21093_low_24 (Length: 272)
Name: NF21093_low_24
Description: NF21093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21093_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 5934225 - 5934013
Alignment:
| Q |
18 |
actctctctaagctaggctgggatatggttttggaaatgccaaatttatatactaacaaaaaggagttaagattatgttctccatatcttcttcctttac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5934225 |
actctctctaagctaggctgggatatggttttggaaatgccaaatttatatactaacaaaaaggagttaagattatgttctccatatcttcttcctttac |
5934126 |
T |
|
| Q |
118 |
ttgctgttttggtgaagttatatttatttatttcagccgaaagaacacttatttaatgtaatgtaacgtgga-cctatgtacaaaaacttgtgtggggtc |
216 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
5934125 |
ttgctgttttggtgatgttatatttatttatttcagccgaaagaacacttatttaatgtaatgcaacgtggaccctatacacaaaaacttatgtggggtc |
5934026 |
T |
|
| Q |
217 |
ctgccttcactac |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5934025 |
ctgccttcactac |
5934013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 169 - 229
Target Start/End: Complemental strand, 5933995 - 5933934
Alignment:
| Q |
169 |
tttaatgtaatgtaacgtggacc-tatgtacaaaaacttgtgtggggtcctgccttcactac |
229 |
Q |
| |
|
|||||||||||| |||||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
5933995 |
tttaatgtaatgcaacgtggaccctatacacaaaaacttatgtggggtcctgccttcactac |
5933934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University