View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21093_low_25 (Length: 265)

Name: NF21093_low_25
Description: NF21093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21093_low_25
NF21093_low_25
[»] chr6 (1 HSPs)
chr6 (2-249)||(35169829-35170073)


Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 2 - 249
Target Start/End: Complemental strand, 35170073 - 35169829
Alignment:
2 cgagtgaggcgatgagtttgagagattgttttctgatggaaggttttagttcggagtgaatgtcgagaatgcaagagaggaatggggagatggaatgtgg 101  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35170073 cgagtgaagcgatgagtttgagagattgttttctgatggaaggttttagttcggagtgaatgtcgagaatgcaagagaggaatggggagatggaatgtgg 35169974  T
102 agttaatgagtggaggattgtttcgagctctttggttccgatatcgtgtgtgtctcgatctccaactttgtttaatgcattgtgtactctttgcttcatc 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35169973 agttaatgagtggaggattgtttcgagctctttggttccgatatcgtgtgtgtctcgatctccaactttgtttaatgcattgtgtactctttgcttcatc 35169874  T
202 tcgaaattactactactcagcttgttgttggtcttcattgttattgct 249  Q
    ||||||||||   |||||||||||||||||||||||||||||||||||    
35169873 tcgaaattac---tactcagcttgttgttggtcttcattgttattgct 35169829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University