View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21093_low_31 (Length: 237)
Name: NF21093_low_31
Description: NF21093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21093_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 33785620 - 33785407
Alignment:
| Q |
1 |
tattctggtagcatacgtgacaatattttgtttggaaaacaagatgcaagtgaaaatgaagttgttgaggctgctaggtctgcaaatgctcatgacttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33785620 |
tattctggtagcatacgtgacaatattttgtttggaaaacaagatgcaagtgaaaatgaagttgttgaggctgctaggtctgcaaatgctcatgacttca |
33785521 |
T |
 |
| Q |
101 |
tatcgtaagtttcctctttatgca-nnnnnnnnnattatcaagaatcgaactcggtatcctagagtttacaacactcacacactgcgtaccgatcacttg |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33785520 |
tatcgtaagtttcctctttatgcattttttttttattatcaagaatcgaactcggtatcctagagtttacaacactcacacactgcgta-cgatcacttg |
33785422 |
T |
 |
| Q |
200 |
cgtttgaacctgata |
214 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33785421 |
cgtttgaacctgata |
33785407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University