View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21093_low_34 (Length: 209)
Name: NF21093_low_34
Description: NF21093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21093_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 5e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 12 - 192
Target Start/End: Complemental strand, 6226691 - 6226511
Alignment:
| Q |
12 |
agcagagatcataaagtgtttgtcatcctcaagnnnnnnncccaggacatcagggatatcgttacgcgcgagnnnnnnncccagtctggctctcctcaag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
6226691 |
agcagagatcataaagtgtttgtcatcctcaagtttttttcccaggacattagggatatagttacgcgcgagtttttttcccagtctagctctcctcaag |
6226592 |
T |
 |
| Q |
112 |
ttctcattaccaccgacccccagctttgtggtgcagatgtgcataaagtgtctctgattgtaaactatgatctcccaactg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
6226591 |
ttctcattaccaccgacccccagctttgtggtgcagatgtgcataaagcgtctctgatcgtaaactatgatctcccaactg |
6226511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 94 - 192
Target Start/End: Complemental strand, 6233867 - 6233769
Alignment:
| Q |
94 |
agtctggctctcctcaagttctcattaccaccgacccccagctttgtggtgcagatgtgcataaagtgtctctgattgtaaactatgatctcccaactg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
6233867 |
agtctggctctcctcaagttctcattaccaccgaccccctcgtttgtggtacagatttgcataaagcgtctctggtcgtaaactatgatctcccaactg |
6233769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 91 - 188
Target Start/End: Original strand, 17545504 - 17545601
Alignment:
| Q |
91 |
cccagtctggctctcctcaagttctcattaccaccgacccccagctttgtggtgcagatgtgcataaagtgtctctgattgtaaactatgatctccca |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| | |||||||| |||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
17545504 |
cccagtctggctctcctcatgttctcattaccacagaccccttggtttgtggtacagatgtgcataaagtatctctgatcgtaaactatgatctccca |
17545601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University