View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21094_high_4 (Length: 250)
Name: NF21094_high_4
Description: NF21094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21094_high_4 |
 |  |
|
| [»] chr5 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 127 - 250
Target Start/End: Complemental strand, 33595913 - 33595790
Alignment:
| Q |
127 |
cccctcttgcagaacaggttttccttgtgctattaagataattgttcacaaaagtatgcaaatagacaaaaggtcaatgcttcttgtgagcttaaattta |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33595913 |
cccctcttgcagaacaggttttccttgtgctattaagataattgttcacaaaactatgcaaatagaccaaaggtcaatgcttcttgtgagcttaaattta |
33595814 |
T |
 |
| Q |
227 |
agcaggtcttgctaagggttcagc |
250 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33595813 |
agcaggtcttgctaagggttcagc |
33595790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 13 - 91
Target Start/End: Complemental strand, 33596027 - 33595949
Alignment:
| Q |
13 |
taggtaagtaacattgattgtctcaatttggactttgagtgcattatataagaagtaaatattgcttcatataatttgg |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33596027 |
taggtaagtaacattgattgtctcaatttggactttgagtgcattatataagaagtaaatattgcttcatataatttgg |
33595949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 13 - 91
Target Start/End: Original strand, 37237609 - 37237688
Alignment:
| Q |
13 |
taggtaagtaacattgattgtctcaatttggacttt-gagtgcattatataagaagtaaatattgcttcatataatttgg |
91 |
Q |
| |
|
||||||||||||||||||| ||||||||| | ||| || || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37237609 |
taggtaagtaacattgattatctcaattttcatttttgaatgatttatagaagaagtaaatattgcttcatataatttgg |
37237688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 225
Target Start/End: Original strand, 37237778 - 37237835
Alignment:
| Q |
168 |
ttgttcacaaaagtatgcaaatagacaaaaggtcaatgcttcttgtgagcttaaattt |
225 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37237778 |
ttgttcacaaaaatatgagaatggacaaaaggtcaatgcttcctgtgagcttaaattt |
37237835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University