View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21094_low_7 (Length: 220)
Name: NF21094_low_7
Description: NF21094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21094_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 59 - 193
Target Start/End: Original strand, 53118886 - 53119025
Alignment:
| Q |
59 |
tatttaccaaaaccgttgcaaattaagcaagtgaacaatttcttttggtggctatgaagctagtgaacatgctacgcaattttaagcactcgatgcatta |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53118886 |
tatttaccaaaaccgttgcaaattaagcaagtgaacaatttcttttggtggctatgaagctagtgaacatgctacgcaattttaagcactcgatgcatta |
53118985 |
T |
 |
| Q |
159 |
tggagt-----gagtgaacaattctatacatgtgtgtgtg |
193 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| |
|
|
| T |
53118986 |
tggagttaaacgagtgaacaattatatacatgtgtgtgtg |
53119025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 53118806 - 53118848
Alignment:
| Q |
20 |
cttaccaactaaattaatgcttaatttttatcacaataatatt |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53118806 |
cttaccaactaaattaatgcttaatttttatcacaataatatt |
53118848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University