View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21095_low_4 (Length: 251)
Name: NF21095_low_4
Description: NF21095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21095_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 14441681 - 14441448
Alignment:
| Q |
1 |
gacctccccaaacaaccctgatgggactcttcgaacaccagtggtgaactcagaagctgaagggaaactaatttatgatttggcctattactggccacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14441681 |
gacctccccaaacaaccctgatgggactcttcgaacaccagtggtgaactcggaagttgaagggaaactaatttatgatttggcctattactggccacaa |
14441582 |
T |
|
| Q |
101 |
tacactccaattactcaccagattaatcaagatgttacgctcttcacgttatccaaatgcaccggtcatggtggttcccgtatcgggtgagtctctaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14441581 |
tacactccaattactcaccagattaatcaagatgttacgctcttcacgttatccaaatgcaccggtcatggtggttcccgtatcgggtgagtctctaaga |
14441482 |
T |
|
| Q |
201 |
tcgcagttgcaatcttgcagaaactgttagatat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
14441481 |
tcgcagttgcaatcttgcagaaactgttagatat |
14441448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 5 - 192
Target Start/End: Complemental strand, 14433346 - 14433159
Alignment:
| Q |
5 |
tccccaaacaaccctgatgggactcttcgaacaccagtggtgaactcagaagctgaagggaaactaatttatgatttggcctattactggccacaataca |
104 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||||||||||||| | |||| |||||||| | ||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
14433346 |
tccccaaacaaccctgatggaacccttcgtgtaccagtggtgaactctgcagctaaagggaaattgattcatgacttggcctattattggccacaataca |
14433247 |
T |
|
| Q |
105 |
ctccaattactcaccagattaatcaagatgttacgctcttcacgttatccaaatgcaccggtcatggtggttcccgtatcgggtgagt |
192 |
Q |
| |
|
|||| |||||| | || | | || ||||| | ||||||||| || ||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
14433246 |
ctcctattacttatgaggctgaccatgatgtaatgctcttcacattctccaaatgcactggtcatgctggttcccgtatagggtgagt |
14433159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University