View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21097_high_67 (Length: 318)
Name: NF21097_high_67
Description: NF21097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21097_high_67 |
 | |
|
| [»] scaffold0077 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 46221136 - 46221437
Alignment:
| Q |
1 |
cacagatcacgtgcatatcaatctagtaatttcatcaactccctagcaaacctagaatttagcgattgaattcaaccgcgcgtgagatatccaggcaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221136 |
cacagatcacgtgcatatcaatctagtaatttcatcaactccctaacaaacctagaatttagcgattgaattcaaccgcgcgtgagatatccaggcaaag |
46221235 |
T |
|
| Q |
101 |
gactagcgcgtggagacctgatcggaacttcacgcgtctgtttcccgttaatatcgtagtaaatcacaccggagaaatccaacggctcacactttcctcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221236 |
gactagcgcgtggagacctgatcggaacttcacgcgtctgtttcccgttaatatcgtagtaaatcacaccggagaaatccaacggctcacactttcctcc |
46221335 |
T |
|
| Q |
201 |
catcaaaatctccttctgccaaacgccgccgtttccccaaccttcctnnnnnnnnnnnnnnnnnngcttcttcttcccgaattgcgacagtgctttgttg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221336 |
catcaaaatctccttctgccaaacgccgccgtttccccaaccttccttctctctctcctctctctgcttcttcttcccgaattgcgacagtgctttgttg |
46221435 |
T |
|
| Q |
301 |
ct |
302 |
Q |
| |
|
|| |
|
|
| T |
46221436 |
ct |
46221437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 97 - 234
Target Start/End: Complemental strand, 29831134 - 29830997
Alignment:
| Q |
97 |
aaaggactagcgcgtggagacctgatcggaacttcacgcgtctgtttcccgttaatatcgtagtaaatcacaccggagaaatccaacggctcacactttc |
196 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||| || ||| | ||||||||||| || | ||| || || |||||||||||||||||||| |||| |
|
|
| T |
29831134 |
aaaggaatagcgcgtggagacctgagaggaacttcaccggtttgtcttccgttaatatcataatgaataacgcctgagaaatccaacggctcacattttc |
29831035 |
T |
|
| Q |
197 |
ctcccatcaaaatctccttctgccaaacgccgccgttt |
234 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||| ||||| |
|
|
| T |
29831034 |
ctcccatcaatatctccttctgccaaacaccgtcgttt |
29830997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0077 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0077
Description:
Target: scaffold0077; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 138 - 224
Target Start/End: Original strand, 10435 - 10521
Alignment:
| Q |
138 |
ctgtttcccgttaatatcgtagtaaatcacaccggagaaatccaacggctcacactttcctcccatcaaaatctccttctgccaaac |
224 |
Q |
| |
|
||||||||| ||| | || || ||||||||||| |||||||||||||| |||||||| | |||||||| ||| ||||||||||| |
|
|
| T |
10435 |
ctgtttccccttattgtcataataaatcacaccagagaaatccaacggttcacacttatcacccatcaagatcgttttctgccaaac |
10521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University